| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.182352 |
| Chromosome: | chromosome 17 |
| Location: | 6159806 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741700 | KIL22 | Putative kinesin-like motor protein; (1 of 1) PTHR24115//PTHR24115:SF421 - FAMILY NOT NAMED // KINESIN-LIKE PROTEIN KIF25 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGCCAGACGCGTCGTGGCCGCTGCCAG |
| Internal bar code: | TCGCAGATTCGTTTCAGAATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 324 |
| LEAP-Seq percent confirming: | 99.6881 |
| LEAP-Seq n confirming: | 2557 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAGCATCTGAACTGGAGG |
| Suggested primer 2: | ACGGTATGCTGCAAGTCTCC |