| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.182356 |
| Chromosome: | chromosome 11 |
| Location: | 2449023 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475400 | (1 of 1) K11864 - BRCA1/BRCA2-containing complex subunit 3 (BRCC3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATGGAATCCAAACCCGAAGCCGGGGTCC |
| Internal bar code: | TACATTGGCGGGTATACTAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 940 |
| LEAP-Seq percent confirming: | 99.4628 |
| LEAP-Seq n confirming: | 3703 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAACCCACAATGACACG |
| Suggested primer 2: | ACCCCAGTAAGGGCGTCTAT |