Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.182385 |
Chromosome: | chromosome 10 |
Location: | 5313671 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g457700 | (1 of 1) K08794 - calcium/calmodulin-dependent protein kinase I (CAMK1); calcium/calmodulin-dependent protein kinase type 1D-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAAGTTGGTCGCAGGGTCAACACGGCGG |
Internal bar code: | GGGGGCGCGGACTCGGCGCGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1055 |
LEAP-Seq percent confirming: | 97.7512 |
LEAP-Seq n confirming: | 3434 |
LEAP-Seq n nonconfirming: | 79 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGAGCACAATGGACAAGA |
Suggested primer 2: | TTGACTGAGGAACGAGCCTT |