Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.182401 |
Chromosome: | chromosome 12 |
Location: | 1363870 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g488400 | KATL5 | katanin like protein 5, similar to the catalytic subunit; (1 of 9) 3.6.4.3 - Microtubule-severing ATPase / Katanin | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGCGGATTGCAATGTGCAATGTCAGTA |
Internal bar code: | TAGTGCCCGCGCATGGAAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 11.5316 |
LEAP-Seq n confirming: | 259 |
LEAP-Seq n nonconfirming: | 1987 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGACTTGGTGGCATGTGTT |
Suggested primer 2: | TCCACCTCGTCCTGATTTTC |