| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.182404 |
| Chromosome: | chromosome 16 |
| Location: | 3009936 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g664750 | (1 of 1) IPR000225//IPR016024//IPR021133 - Armadillo // Armadillo-type fold // HEAT, type 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGGCGTACGTTGGGCGGGGAGGTTCAG |
| Internal bar code: | CACTTATGGAGCATTAAAAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 744 |
| LEAP-Seq percent confirming: | 99.0177 |
| LEAP-Seq n confirming: | 24798 |
| LEAP-Seq n nonconfirming: | 246 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATTGGGTAGCCTGTGTTT |
| Suggested primer 2: | TTCCAGGGAAGAACATCCAC |