| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.182505 |
| Chromosome: | chromosome 10 |
| Location: | 3002229 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440950 | FAP192 | (1 of 1) PTHR14465//PTHR14465:SF0 - IQ DOMAIN-CONTAINING PROTEIN H // IQ DOMAIN-CONTAINING PROTEIN H; Flagellar Associated Protein 192 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCAACGCTCTTGCAGCAGCCGAAGAACG |
| Internal bar code: | TTTAGCAACCTATGTAAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 749 |
| LEAP-Seq percent confirming: | 99.5395 |
| LEAP-Seq n confirming: | 1297 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAGAGGGTTCCGCAGTAG |
| Suggested primer 2: | ATACAAACACAGCCCCTTCG |