Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.182537 |
Chromosome: | chromosome 1 |
Location: | 1019662 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g005813 | POB31 | Proteome of basal body 31 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGGGGCTCGCGACCATCAACGAAACCA |
Internal bar code: | GGCGGTACAGAATATTTAGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 518 |
LEAP-Seq percent confirming: | 98.4066 |
LEAP-Seq n confirming: | 1544 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGAATAGGTCCGTCCACAG |
Suggested primer 2: | TCCATCTCCCTCATCTGTCC |