Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.182572 |
Chromosome: | chromosome 12 |
Location: | 735563 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g495250 | FAL15,FAP31 | TPR-Repeat Flagellar Associated Protein 31; (1 of 14) PF13424 - Tetratricopeptide repeat (TPR_12) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAGGTTAAGCAGGAAGTGCATTCCGGCC |
Internal bar code: | TAGCTCAGGTGTTGTGAGTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 66 |
LEAP-Seq percent confirming: | 99.3007 |
LEAP-Seq n confirming: | 142 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTGGCGTAAGAGTTCAG |
Suggested primer 2: | TAGAGCTGGCCGAAAACACT |