Insertion junction: LMJ.RY0402.182629_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.182629
Chromosome:chromosome_3
Location:3739594
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g169750 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ACCTGCCGCGTGCGCCCACCCTGACCGATG
Internal bar code:GAGTCCGGTCGCAGCGGCGGAT

Confirmation - LEAP-Seq

LEAP-Seq distance:763
LEAP-Seq percent confirming:89.0196
LEAP-Seq n confirming:3632
LEAP-Seq n nonconfirming:448
LEAP-Seq n unique pos:37

Suggested primers for confirmation by PCR

Suggested primer 1:AAGTCCCATCATCAAGTGGC
Suggested primer 2:GGGATTGTAGGAGCCTGTGA