Insertion junction: LMJ.RY0402.182629_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.182629
Chromosome:chromosome_3
Location:3739594
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g169750 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TTTGGCGCCACGGAGGTCGACCCAAGCCCC
Internal bar code:CTATTAGCTACGCTTGCTAACG

Confirmation - LEAP-Seq

LEAP-Seq distance:623
LEAP-Seq percent confirming:98.7705
LEAP-Seq n confirming:241
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:AAGTCCCATCATCAAGTGGC
Suggested primer 2:GGGATTGTAGGAGCCTGTGA