| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.182688 |
| Chromosome: | chromosome 12 |
| Location: | 4416606 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g520950 | BOP5,IDA-IC138,IC138,DIC4 | Axonemal inner dynein arm I1 intermediate chain; (1 of 1) PTHR12442:SF12 - WD REPEAT-CONTAINING PROTEIN 78 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGTCCAGCAAGGCATATGACGTGCTCC |
| Internal bar code: | TCTTCTTCGTCATGCTAACTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 504 |
| LEAP-Seq percent confirming: | 99.5439 |
| LEAP-Seq n confirming: | 3492 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAAGACCAGCAACGCATA |
| Suggested primer 2: | CAGCAGCAGCCAGTCAGTAG |