| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.182704 |
| Chromosome: | chromosome 3 |
| Location: | 406124 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144887 | (1 of 1) IPR000048//IPR003590//IPR006553 - IQ motif, EF-hand binding site // Leucine-rich repeat, ribonuclease inhibitor subtype // Leucine-rich repeat, cysteine-containing subtype | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCCGTGGAATAAACCGCGAAGCATTGC |
| Internal bar code: | TATCTTGTCCCTGTCCAGGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 565 |
| LEAP-Seq percent confirming: | 99.0691 |
| LEAP-Seq n confirming: | 4257 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCGAGTAGACAGTGCTCG |
| Suggested primer 2: | CAGCAGGCATCTCCTCCTAC |