Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.182761 |
Chromosome: | chromosome 7 |
Location: | 5562449 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g351550 | (1 of 1) PTHR31319//PTHR31319:SF1 - FAMILY NOT NAMED // CCT MOTIF FAMILY PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCACATCGCCCTGGCCGTAACTCGTGCG |
Internal bar code: | CCCGGACACTATTTGGGTCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 661 |
LEAP-Seq percent confirming: | 99.6071 |
LEAP-Seq n confirming: | 4310 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACTGCAATCACTCGGCAA |
Suggested primer 2: | AGCAACAAAACACACCACCA |