| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.182803 |
| Chromosome: | chromosome 13 |
| Location: | 1737273 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574500 | FER2 | (1 of 2) K00522 - ferritin heavy chain (FTH1); Ferritin subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCCATCCCCGCTCACCTGCTCGTGAA |
| Internal bar code: | ACGCATTGCCAGTCGTGACTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 146 |
| LEAP-Seq percent confirming: | 76.3636 |
| LEAP-Seq n confirming: | 84 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGGGGGTTTGCAAGTTA |
| Suggested primer 2: | GCTGTAGTAGTGCGATGCCA |