| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.182817 |
| Chromosome: | chromosome 3 |
| Location: | 7444471 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205800 | (1 of 2) PTHR15440:SF0 - PROTEIN XRP2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACACACACACACAGGGGAAGGGAAGG |
| Internal bar code: | GTATCGCATTCGTTCGATCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 951 |
| LEAP-Seq percent confirming: | 95.1528 |
| LEAP-Seq n confirming: | 903 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACGCACCGATACCTACCC |
| Suggested primer 2: | TCACCCTCCTTGAGTATGGC |