| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.182831 |
| Chromosome: | chromosome 6 |
| Location: | 3519751 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278108 | (1 of 5) PF13508 - Acetyltransferase (GNAT) domain (Acetyltransf_7) | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCCCTTCTTCATCCCCCTGCCCATCAA |
| Internal bar code: | GGCACAGGGTTGTAACGTAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1116 |
| LEAP-Seq percent confirming: | 99.7341 |
| LEAP-Seq n confirming: | 6751 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGACACGGGTAGCAGGAG |
| Suggested primer 2: | AGTTCACCTGTTGGGTCGTC |