| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.182893 |
| Chromosome: | chromosome 3 |
| Location: | 6595347 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g196300 | (1 of 1) K15045 - radical S-adenosyl methionine domain-containing protein 2 (RSAD2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGATGCTGGGCCCATACTCATAGCCCTCT |
| Internal bar code: | GTGAGCTACTCGAGCAGGCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1041 |
| LEAP-Seq percent confirming: | 99.7998 |
| LEAP-Seq n confirming: | 3489 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCGTATCCACCAGCCTTG |
| Suggested primer 2: | CTGGACTGGATTGCCTTCTC |