| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.182917 |
| Chromosome: | chromosome 9 |
| Location: | 3905210 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392245 | DPMS3,DPM3 | (1 of 1) PF08285 - Dolichol-phosphate mannosyltransferase subunit 3 (DPM3) (DPM3); Dolicol-phosphate mannosyltransferase 3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCCCCCGGGCGATTGCTCAACAAGCGC |
| Internal bar code: | TCGGGCGATCAATACGATCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 974 |
| LEAP-Seq percent confirming: | 99.0821 |
| LEAP-Seq n confirming: | 8851 |
| LEAP-Seq n nonconfirming: | 82 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACTCTTCAGCGGGTCGAG |
| Suggested primer 2: | GGGCAGCACGGTAGTTGTAT |