| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.182990 |
| Chromosome: | chromosome 10 |
| Location: | 5014468 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455500 | GTF4 | (1 of 2) PF17035 - Bromodomain extra-terminal - transcription regulation (BET); Global Transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCTCCCACAACGCTATCCATCAAGGCC |
| Internal bar code: | TTTAGCCATTTTCTCTCGTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 232 |
| LEAP-Seq percent confirming: | 99.5187 |
| LEAP-Seq n confirming: | 3929 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCACCGTGTGCTGTGTT |
| Suggested primer 2: | GCGTAGCAAGAAGGGACAAG |