Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.183000 |
Chromosome: | chromosome_3 |
Location: | 5258308 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre03.g183200 | CPC1 | Protein associated with central pair microtubule complex | sense | CDS |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CGGCGGTGTGCCCGCCCGCGAGACAGTGTC |
Internal bar code: | GCTTTGTAACGCTTCTGAGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 874 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 81 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACCAGTGTGGCTAGCAT |
Suggested primer 2: | TCTTCTCAGTGACAGCCGTG |