Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.183024 |
Chromosome: | chromosome 12 |
Location: | 540784 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g492850 | POC19 | Proteome of centriole protein 19; (1 of 1) PF10595 - Uncharacterised protein family UPF0564 (UPF0564) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCGATGGAGGCGCGCGGGGCGAGGCGT |
Internal bar code: | GGTGACATAGCCTAAGGAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 215 |
LEAP-Seq percent confirming: | 99.1342 |
LEAP-Seq n confirming: | 229 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATCAGCAGGCTCCCTCCTA |
Suggested primer 2: | CTGGCACGATCAGCTGTTTA |