| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.183036 |
| Chromosome: | chromosome 11 |
| Location: | 1633662 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467768 | (1 of 1) K10277 - lysine-specific demethylase 8 [EC:1.14.11.27] (KDM8, JMJD5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCCCGTCCTACAACTCAGCTCCCCCGC |
| Internal bar code: | GAAAATCTATCGTATTTAGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 477 |
| LEAP-Seq percent confirming: | 91.3401 |
| LEAP-Seq n confirming: | 2890 |
| LEAP-Seq n nonconfirming: | 274 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTGTGAGGGTCATGAGCTG |
| Suggested primer 2: | GTTACTGCGGTAAAGGCACG |