| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.183128 |
| Chromosome: | chromosome 10 |
| Location: | 3917004 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g448150 | (1 of 6) PF01847 - von Hippel-Lindau disease tumour suppressor protein (VHL) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCGGCTGCCGCCACCGCCTGCGCAATG |
| Internal bar code: | GTGGGAACTTGGACTTCGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 955 |
| LEAP-Seq percent confirming: | 41.573 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTTCTGCCATTTGCCTTA |
| Suggested primer 2: | AGTTACAATGACGCCCGAAC |