| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.183213 |
| Chromosome: | chromosome 16 |
| Location: | 5547612 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g680300 | (1 of 4) 2.3.1.43 - Phosphatidylcholine--sterol O-acyltransferase / Phospholipid--cholesterol acyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAAAGTGCCATCCTCTCTTTCCGCGGCA |
| Internal bar code: | TGGGTCTGCGACGGGCTCAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 423 |
| LEAP-Seq percent confirming: | 99.6707 |
| LEAP-Seq n confirming: | 908 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGGACAGGACAGGGAGGT |
| Suggested primer 2: | CGTAGCAGGAGCCTTGAATC |