Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.183230 |
Chromosome: | chromosome 16 |
Location: | 5850357 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g677700 | NUP62 | Nucleoporin 62; (1 of 1) K14306 - nuclear pore complex protein Nup62 (NUP62, NSP1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATATGAGTCCCCTCGCAAGCCCAAACGGC |
Internal bar code: | TCGAACCCCGGGATATGCGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 194 |
LEAP-Seq percent confirming: | 98.9451 |
LEAP-Seq n confirming: | 938 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCAGGAGTTCACACAAGAA |
Suggested primer 2: | CAGACACAGAACTCAGCCCA |