| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.183303 |
| Chromosome: | chromosome 3 |
| Location: | 1862225 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154750 | (1 of 4) 2.3.1.43 - Phosphatidylcholine--sterol O-acyltransferase / Phospholipid--cholesterol acyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCTGACACGGCTGCTACATCATTCCCCG |
| Internal bar code: | GGCTGCGGTTAGTAAAGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 308 |
| LEAP-Seq percent confirming: | 88.3481 |
| LEAP-Seq n confirming: | 4284 |
| LEAP-Seq n nonconfirming: | 565 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTCACCCACACGCTACTG |
| Suggested primer 2: | CGCAGGTGGATTCATACCTT |