Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.183344 |
Chromosome: | chromosome 4 |
Location: | 2606005 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g222650 | (1 of 18) PTHR19862//PTHR19862:SF14 - FAMILY NOT NAMED // WD REPEAT-CONTAINING PROTEIN 48 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCTGCCGCCACCGCCGCCGCCGCCGTC |
Internal bar code: | GATGGGACTTATGTTTTACGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 292 |
LEAP-Seq percent confirming: | 99.793 |
LEAP-Seq n confirming: | 964 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTATTGGCCACCCTTCTTG |
Suggested primer 2: | CTAATCGTGGCGTCCTTCAT |