| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.183348 |
| Chromosome: | chromosome 3 |
| Location: | 4168404 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g173750 | POB19 | Proteome of basal body 19; (1 of 80) IPR003882 - Pistil-specific extensin-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCCGAATTGGCTTCCAGCTCCACGGGG |
| Internal bar code: | GGGCATGTTTAGCCCGTACCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 416 |
| LEAP-Seq percent confirming: | 83.3766 |
| LEAP-Seq n confirming: | 2247 |
| LEAP-Seq n nonconfirming: | 448 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTAGAGAAGGAGCGGTGG |
| Suggested primer 2: | AGCATGCACCTGCACCAC |