Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.183357 |
Chromosome: | chromosome 12 |
Location: | 7780384 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g553650 | (1 of 3) PTHR13887:SF10 - FRNE PROTEIN-LIKE | 3'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCTTCGTCGCCCGCAACATCGAGTCAA |
Internal bar code: | GGCACCGACCAAGGGGGGTCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 739 |
LEAP-Seq percent confirming: | 99.6724 |
LEAP-Seq n confirming: | 1217 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCGAAGTCGAAATGCTAA |
Suggested primer 2: | CAGCCGTTTTAATGACCGTT |