Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.183508 |
Chromosome: | chromosome 4 |
Location: | 3293462 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g226900 | (1 of 1) PTHR15441:SF1 - RIBONUCLEASE P PROTEIN SUBUNIT P14 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGACGTGTTGATGACGCTGCAGCGAGTAC |
Internal bar code: | CGCTTTCAAAAACTGTGATCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 752 |
LEAP-Seq percent confirming: | 95.3981 |
LEAP-Seq n confirming: | 2612 |
LEAP-Seq n nonconfirming: | 126 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCTGAGCCAAGCACTTTCC |
Suggested primer 2: | ACCCCAACACCTTTTCAGAG |