Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.183523 |
Chromosome: | chromosome 3 |
Location: | 2337340 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g158464 | (1 of 1) PTHR13561//PTHR13561:SF26 - DNA REPLICATION REGULATOR DPB11-RELATED // F5A8.9 PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGTGGCCGCAGGCGCAACACAGCCAGGA |
Internal bar code: | GCGCTGGTCTGAGCGCACAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 785 |
LEAP-Seq percent confirming: | 97.7124 |
LEAP-Seq n confirming: | 1196 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGGAAGTCGGTTGGTTGAG |
Suggested primer 2: | GCCTACGCTGTAAGGGACAG |