| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.183524 |
| Chromosome: | chromosome 6 |
| Location: | 2448770 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268700 | POB28 | Proteome of basal body 28; (1 of 1) PTHR18937//PTHR18937:SF224 - STRUCTURAL MAINTENANCE OF CHROMOSOMES SMC FAMILY MEMBER // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCGCGTGTCGTCCAGCCGGGCGGCCC |
| Internal bar code: | GGCGCCATTCGTGAGGTCCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 870 |
| LEAP-Seq percent confirming: | 98.4711 |
| LEAP-Seq n confirming: | 2061 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGTCCAACCCGCTTACCA |
| Suggested primer 2: | GTGGGGGAGAAGGAAAAGAC |