| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.183566 |
| Chromosome: | chromosome 6 |
| Location: | 4894776 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279183 | GEX150 | (1 of 1) PF09808 - Small nuclear RNA activating complex (SNAPc), subunit SNAP43 (SNAPc_SNAP43) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTAAAATCACGTGCATGATTGCATGGGA |
| Internal bar code: | AACATTGTGGGGGTCGACCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 938 |
| LEAP-Seq percent confirming: | 98.381 |
| LEAP-Seq n confirming: | 2066 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCGCAGAGTGTCAGAAG |
| Suggested primer 2: | GTTTGGACTGGCAACACCTT |