| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.183632 |
| Chromosome: | chromosome 3 |
| Location: | 6378030 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g194100 | MAPKKK3 | (1 of 1) PF14381 - Ethylene-responsive protein kinase Le-CTR1 (EDR1); Mitogen-Activated Protein Kinase Kinase Kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGCAAGCTGGCTGTGTTTGAGACTCTTG |
| Internal bar code: | CCTGCAGAACGTTTGGCAAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 555 |
| LEAP-Seq percent confirming: | 99.6942 |
| LEAP-Seq n confirming: | 15320 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACGTAGCTCTGGATCTC |
| Suggested primer 2: | GCTCGAGTTTAGGCAGGTTG |