| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.183658 |
| Chromosome: | chromosome 10 |
| Location: | 5645217 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g460350 | PGA4 | Putative phospholipid/glycerol acyltransferase; (1 of 3) 2.3.1.25 - Plasmalogen synthase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAGGCAATCAGCCATGGCTGACCTCAC |
| Internal bar code: | CGATGTCTTCGACATCACCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 321 |
| LEAP-Seq percent confirming: | 17.8209 |
| LEAP-Seq n confirming: | 193 |
| LEAP-Seq n nonconfirming: | 890 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTAGAGGTCGGAACCCTCC |
| Suggested primer 2: | GGTCGTTGTGGGATGAGTCT |