Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.183708 |
Chromosome: | chromosome 9 |
Location: | 3451396 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389356 | (1 of 1) K03457 - nucleobase:cation symporter-1, NCS1 family (TC.NCS1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATCAGCCCAGCCGGCGCGGGGCCACGTG |
Internal bar code: | GAGAGTGTGTCAACGCTGAGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 919 |
LEAP-Seq percent confirming: | 99.388 |
LEAP-Seq n confirming: | 1624 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTACTTGCTCTTGATCCG |
Suggested primer 2: | GCACATTGAGACAGGAGCAA |