| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.183743 |
| Chromosome: | chromosome 12 |
| Location: | 1526749 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g487101 | CSV9 | Chlamydomonas-specific family protein; (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCAGACCAGCTTTATTGCAAGCAGTCTT |
| Internal bar code: | CAGTAGCGTGCGTGCCTTGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 71.0354 |
| LEAP-Seq n confirming: | 542 |
| LEAP-Seq n nonconfirming: | 221 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTTCCAAACGTTGATTG |
| Suggested primer 2: | CGATGGCTCCTTCACCATAC |