| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.183760 |
| Chromosome: | chromosome 7 |
| Location: | 2014246 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325760 | MAW10 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase; Membrane-associated hydroxyproline-rich glycoprotein 10 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATACATCCTGACGAAAGAAAGAACTGGT |
| Internal bar code: | CGTTACGGTCTTGGGCTATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 324 |
| LEAP-Seq percent confirming: | 42.5358 |
| LEAP-Seq n confirming: | 208 |
| LEAP-Seq n nonconfirming: | 281 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCAGCTATTTGCAGCCAC |
| Suggested primer 2: | TCATCGTCATCGTCTTCAGC |