| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.183825 |
| Chromosome: | chromosome 7 |
| Location: | 1092614 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319900 | RRP40 | 3'-5' Exonuclease component of the Exosome; (1 of 1) K03681 - exosome complex component RRP40 (RRP40, EXOSC3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGACAATGATAAACGATGCTAGAGGTAT |
| Internal bar code: | TGGTCATGGCACGGGGCTGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1020 |
| LEAP-Seq percent confirming: | 99.6507 |
| LEAP-Seq n confirming: | 20255 |
| LEAP-Seq n nonconfirming: | 71 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATAAGTGGTGACGTGGC |
| Suggested primer 2: | CTGCCTGGACAGGGTATGTT |