| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.183873 |
| Chromosome: | chromosome 1 |
| Location: | 2861184 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017250 | FKB99 | Chlorophyceae-specific protein; (1 of 2) K09571 - FK506-binding protein 4/5 (FKBP4_5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCACGCCTATGGCACATCCGGCTTGCG |
| Internal bar code: | GCCTCGACGTGGGCGCGCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 223 |
| LEAP-Seq percent confirming: | 79.3834 |
| LEAP-Seq n confirming: | 824 |
| LEAP-Seq n nonconfirming: | 214 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATGTACACCTGTGCGTTG |
| Suggested primer 2: | CTTGTCCCTTGCTCCGTAAG |