Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.183881 |
Chromosome: | chromosome 2 |
Location: | 6860143 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g119500 | (1 of 726) IPR011009 - Protein kinase-like domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCAGCAACCACGCCAGACCCAGTGTAC |
Internal bar code: | TCGAACGTGCAGTAAAGCCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 693 |
LEAP-Seq percent confirming: | 98.7427 |
LEAP-Seq n confirming: | 1021 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGCTGTGCCTGTCTCAAA |
Suggested primer 2: | TCCGCAGACACAAGCACTAC |