| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.183905 |
| Chromosome: | chromosome 11 |
| Location: | 2472054 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475600 | FAP362 | Flagellar Associated Protein 362; (1 of 239) IPR016024 - Armadillo-type fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCATTAACATCCTTAGCAGCAGCACGCA |
| Internal bar code: | GTGGGTCGCAACGTGCCAGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 686 |
| LEAP-Seq percent confirming: | 99.311 |
| LEAP-Seq n confirming: | 3027 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGAGATGCTACAGCCGAT |
| Suggested primer 2: | TTTGGTAAAGTTTGGGCTGG |