| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.183905 |
| Chromosome: | chromosome 14 |
| Location: | 2557656 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625625 | FTSH11 | FtsH-like membrane ATPase/metalloprotease; (1 of 2) IPR000642//IPR003593//IPR005936//IPR011704//IPR027417 - Peptidase M41 // AAA+ ATPase domain // Peptidase, FtsH // ATPase, dynein-related, AAA domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGGCAACGGGCCCTGCTACACGGTAGGT |
| Internal bar code: | CAGGGTTCCCCATCAGACGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 779 |
| LEAP-Seq percent confirming: | 93.4106 |
| LEAP-Seq n confirming: | 4834 |
| LEAP-Seq n nonconfirming: | 341 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGTACAGGATTGACCGC |
| Suggested primer 2: | CATCCTCTTCACAGCAGCAG |