Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.183909 |
Chromosome: | chromosome 2 |
Location: | 3292976 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095082 | (1 of 4) PF00956 - Nucleosome assembly protein (NAP) (NAP) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGAAACACGCACCAGTACACACACGCTC |
Internal bar code: | GAATGTCCGTAGAGGGCCGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 777 |
LEAP-Seq percent confirming: | 95.9504 |
LEAP-Seq n confirming: | 2630 |
LEAP-Seq n nonconfirming: | 111 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCTGCCATTGTGTTACTT |
Suggested primer 2: | CCAGCCCAAACTAAACCAAA |