| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.183913 |
| Chromosome: | chromosome 7 |
| Location: | 1045568 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319600 | FAE3 | (1 of 3) K15397 - 3-ketoacyl-CoA synthase (KCS); Putative 3-keto-acyl-CoA synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATATGATACGATACGTCCGGAATGATGT |
| Internal bar code: | GTTGGAGGAATCGGGTATATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 66 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTTGGGATTGGAATGACC |
| Suggested primer 2: | GTGAGCAGCAGCAGTAGCAG |