| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.183988 |
| Chromosome: | chromosome 10 |
| Location: | 834917 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423550 | ATA2 | threonine aldolase; (1 of 1) 4.1.2.49 - L-allo-threonine aldolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGACAGCTGCCTAGCCTGCTGCCTGCCT |
| Internal bar code: | GGCGCATACCCCTAGTAGATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 198 |
| LEAP-Seq percent confirming: | 91.0412 |
| LEAP-Seq n confirming: | 1128 |
| LEAP-Seq n nonconfirming: | 111 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTAACAAGGCATTCGAGA |
| Suggested primer 2: | GGGCCAACAAGATAAGGTCA |