Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.183989 |
Chromosome: | chromosome 6 |
Location: | 8226496 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g305700 | (1 of 14) IPR010998 - Integrase, Lambda-type, N-terminal | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGAGGAGGGGTGCCCACGAGGGGTGCCC |
Internal bar code: | GTAGGGGATGTTCTTCGACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 532 |
LEAP-Seq percent confirming: | 95.7733 |
LEAP-Seq n confirming: | 4849 |
LEAP-Seq n nonconfirming: | 214 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGGGTTCACATCTGCTTT |
Suggested primer 2: | ACGTGGCTCTCGCAATAAGT |