| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.184008 |
| Chromosome: | chromosome 14 |
| Location: | 3154970 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628850 | CYG26 | (1 of 70) 4.6.1.2 - Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTTCGCATGACATTGTCATCACATGCC |
| Internal bar code: | CATTTCTAATAACGTATTTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 185 |
| LEAP-Seq percent confirming: | 58.4071 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGCAGTTGCATTGTGAC |
| Suggested primer 2: | CAGCATAGAAGGCTTCGCTC |