Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.184018 |
Chromosome: | chromosome 16 |
Location: | 4799016 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g686400 | FAO13 | FAD-dependent oxidoreductase; (1 of 1) PTHR10742//PTHR10742:SF307 - AMINE OXIDASE // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTGCGACCGAGCTAGTGGCCATGGGCT |
Internal bar code: | CTCGGGTAGTGGAGAACCCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1016 |
LEAP-Seq percent confirming: | 99.571 |
LEAP-Seq n confirming: | 4178 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTCAATGTCGTCGATGCT |
Suggested primer 2: | AGCTGCAGTAGCGACAGGTT |