Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.184039 |
Chromosome: | chromosome 11 |
Location: | 2560284 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g476200 | NZF1 | (1 of 19) PF00642 - Zinc finger C-x8-C-x5-C-x3-H type (and similar) (zf-CCCH); CCCH-type zinc finger protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGGCGATCGCACCAGCCTTCCGCACAC |
Internal bar code: | CAGGGAGCTGGCGGCGCATGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1104 |
LEAP-Seq percent confirming: | 99.6448 |
LEAP-Seq n confirming: | 4208 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAATTGCGGGTTGGTGAGT |
Suggested primer 2: | CTGGAAGCATTCAAAGCACA |